Journal Home
Search for

Volume 75, Issue 1, Pages 14-26 (January 2007)


View previous. 4 of 22 View next.

Regulation of hormone-sensitive lipase in islets

Wen-Jun ShenabCorresponding Author Informationemail address, Yu Lianga, Jenny Wanga, Kenji Haradaa, Shailja Patela, Sara A. Michiec, Jun-Ichi Osugad, Shun Ishibashie, Fredric B. Kraemerab

Received 22 November 2005; accepted 3 May 2006. published online 09 June 2006.

Abstract 

An unique isoform of hormone-sensitive lipase (HSL) is expressed in β-cells. Recent findings suggest that HSL could be involved in the regulation of glucose stimulated insulin secretion (GSIS), however, these findings are controversial. To test the hypothesis that HSL is involved in control of normal GSIS via changes in its expression and/or activity in response to stimuli, we examined the effects of free fatty acid (FFA) loading and glucagon like peptide-1 (GLP-1) stimulation on the regulation of HSL expression and activity. With prolonged FFA loading, there was increased expression of β-cell HSL and increased HSL hydrolytic activity in clonal β-cells. Short-term treatment with GLP-1 increased HSL activity without changing the expression of the β-cell isoform of HSL. Basal insulin secretion was increased, whereas GLP-1 potentiation of GSIS was decreased in islets isolated from HSL−/− mice, as compared to islets from wild type mice. Furthermore, using PancChip 2.2 cDNA microarrays (NIDDK consortium), the gene expression profile in the islets of HSL−/− mice was compared with wild type mice. Results showed changes in several metabolic pathways due to changes in lipid homeostasis caused by inactivation of HSL. Quantitative PCR for selected genes also revealed changes in genes that are related to insulin secretion, such as UCP-2. Therefore, these results suggest that the β-cell isoform of HSL is involved in maintaining lipid homeostasis in islets and contributes to the proper control of GSIS.

Article Outline

Abstract

1. Introduction

2. Materials and methods

2.1. Chemicals and reagents

2.2. Animals

2.3. Islet isolation

2.4. FFA loading of cells

2.5. Insulin secretion analysis

2.6. Histological and morphometric analysis of islets

2.7. Cell culture and transfection

2.8. Measurement of HSL as NCEH or TG lipase activity

2.9. Protein assay and immunoblotting

2.10. Taqman real time PCR analysis

2.11. Microarray analysis of gene expression profile in islets

2.12. Statistical analysis

3. Results

3.1. FFA loading increases the expression and activity of HSL in clonal β-cells

3.2. GLP-1 increases HSL hydrolytic activity in INS-1 cells

3.3. Islets of HSL−/− mice have decreased neutral cholesterol ester hydrolase activity and show decreased GLP-1 potentiated insulin secretion

3.4. Histopathology of HSL−/− mice

3.5. Gene expression profile in islets of HSL−/− mice and wild type mice

4. Discussion

Acknowledgment

References

Copyright

1. Introduction 

return to Article Outline

Hormone-sensitive lipase (HSL) is an intracellular neutral lipase that hydrolyzes stored fat in the form of triacylglycerol (TG), diacylglycerol (DAG) and monoacyglycerol, as well as cholesteryl ester, and releases free fatty acids (FFA) [1]. HSL is predominantly expressed in adipose tissue, and it responds to fast acting hormones through changes in its phosphorylation state, its oligomeric status and its subcellular localization, resulting in a rapid regulation of its hydrolytic activity [1]. For instance, ACTH and catecholamines stimulate its activity, whereas insulin decreases its activity. Therefore, HSL is considered an important regulator of cellular lipid homeostasis and a major modulator of plasma FFA. Although the mechanism is not fully understood, FFA have been shown to be involved in the process of glucose stimulated insulin secretion (GSIS), probably through metabolites that could affect FFA partitioning, such as malonyl-CoA and long-chain acyl-CoA, or DAG, which is both a substrate and a product of HSL hydrolysis. Accumulating data suggest that these lipid derived signals are important for proper GSIS control [2], [3], [4], [5]. Malonyl-CoA has been shown to inhibit carnitine palmitoyltransferase I, thereby enhancing insulin secretion. Long-chain acyl-CoA acutely enhances exocytosis in insulin-secreting cells [6]. DAG has been shown to activate isoforms of PKC, can serve as a substrate for arachidonic acid production and can bind Munc-13, a protein involved in regulated exocytosis [7], [8], [9], and hence plays an important role in regulation of insulin secretion in β-cells [10], [11], [12]. Therefore, proper lipid homeostasis is needed for the normal control of insulin secretion; any disturbances in lipid metabolism in the β-cell induced by high glucose, increased lipid esterification, or protein acylation, might modulate KATP channel-independent insulin secretion.

HSL appears to be expressed as an unique isoform in pancreatic β-cells [13], and the expression of β-cell HSL has been shown to be induced by long-term exposure to high glucose [14]. However, conflicting data have been reported by several investigators in regard to the role of HSL in insulin secretion. Initial observations [15] showed disturbed GSIS in HSL−/− mice, but a recent report from another group [16] showed only impaired insulin sensitivity with intact insulin secretion. All of the HSL−/− mice generated are normoglycemic under basal conditions (normal chow feeding condition), but show a decrease in circulating FFA levels and intolerance to glucose when fasted. Islet TG content was also reported to be increased 2–2.5-fold in HSL−/− mice compared to wild type mice. Therefore, the ablation of the HSL gene has an impact on the normal function of islets in mice, however, whether insulin secretion is affected is debatable. Under basal condition (normal chow feeding condition), there is an increased serum insulin level in HSL−/− mice; after overnight fasting, the serum insulin level is lower in HSL−/− than control mice [17]. As to the role of HSL in insulin secretion, controversial data have been presented as well. Orlistat, a lipase inhibitor, has been shown to inhibit forsklin-stimulated insulin release from rat islets [18]. However, data obtained using isolated islets from 4-month-old HSL−/− mice showed that GLP-1 stimulated insulin release seemed to be intact. In the same publication, decreased GLP-1 stimulated insulin secretion in islets isolated from 7 months old HSL−/− was reported compared with wild type mice, suggesting a compensated insulintropic effect of GLP-1 in HSL−/− mice [19]. In addition to the results obtained with HSL−/− mice, treating isolated rat islets in vitro with a HSL specific inhibitor impaired GLP-1 as well as foskolin potentiated GSIS [20]. Taken together, these findings suggest that HSL could be important in maintaining lipid homeostasis in β-cells and, hence, the regulation of GSIS. In this report, we studied the regulation of HSL activity in β-cells in relation to GSIS under different conditions and analyzed the changes in gene expression profiles in the islets of HSL deficient mice.

2. Materials and methods 

return to Article Outline

2.1. Chemicals and reagents 

Reagents were obtained from the following sources: Bovine serum albumin (fraction V), Ficoll (type 400 DL), GLP-1 (human) and Sigmacoat was from Sigma, St. Louis, MO; fetal bovine serum from Gemini Bio-Products, Inc., Calabasas, CA; Coon's F12/Dulbecco's modified Eagle's media, Lipofectin reagent from Invitrogen, Carlsbad, CA; ECL western blotting detection reagents, horseradish peroxidase-linked whole antibody anti-rabit IgG, cholesteryl [1-14C] oleate from Amersham Life Sciences Products, Arlington Heights, IL; nitrocellulose paper from Schleicher and Schuell, Keene, NH; organic solvents were from J.T. Baker, Phillipsburg, NJ. CMRL, RPMI-1640 media and Hank's balanced salt solution (HBSS) were from GibcoBRL, Gaithersburg, MD, collagenase from Roche Applied Sciences, Indianapolis, IN, TRIzol reagent from Invitrogen, Carlsbad, CA, RNeasy kit from QIAGEN, Valencia, CA. Insulin RIA kit from Linco Research, St. Charles, MO.

2.2. Animals 

HSL−/− mice were generated by homologous recombination as previously described [21]. Mice were maintained in the animal facility at the VA Palo Alto on a 12/12h light/dark cycle. For breeding experiments, mice heterozygous for the deleted HSL allele were used to generate homozygous HSL−/− mice and HSL+/+ wild type littermates. Genotyping was performed by a single-step PCR using three primers as described previously [21]. All experiments were performed with 129/Sv-C57BL6 hybrid descendants. High fat (35.9% (w/w) lard fat) diet and control normal chow (4.8% (w/w) fat) diet were obtained from Research Diets Inc. (New Brunswick, NJ), product numbers D12309 and D12310, respectively. Twelve week-old male HSL+/+ and HSL−/− littermate mice were randomized to either high fat or normal chow diets ad libitum for 15 weeks.

2.3. Islet isolation 

Islets from 6 months old male wild type and HSL−/− mice were isolated using collagenase following established protocols under a dissecting microscope. The ampulla of vater on the duodenum was clamped and the junction of the common bile duct and cystic duct was cannulated. Collagenase solution (25mg/20ml, in HBSS1 with penicillin/streptomycin, 0.02% BSA Fraction V, 0.035% NaHCO3) was quickly injected into the pancreas. All tubes and beakers were treated with Sigmacoat. Three pancrea were incubated together at 37°C for 10–25min. Pancreatic tissue was broken up with a 10ml Sigmacoat-coated glass pipette 3–4 times. The solution was centrifuged at 1000rpm for 30s, and the pellet was further broken up and washed. The pellet was resuspended in 10ml of HBSS1, and passed through a wire mesh strainer. The filtrate was centrifuged and separated in Ficoll gradient (25%, 20.5% and 11%) at 1800rpm for 10min. Islets were collected between 11% and 20.5% ficoll layer, and washed twice before resuspended in 15ml RPMI-1640 media and picked up under a dissecting microscope. Typically, 200–300 islets were generated using three mice pancrea. Islets were allowed to recover overnight in RPMI-1640 media supplemented with 10mM Hepes, 11.1mM glucose and 10% FBS.

2.4. FFA loading of cells 

Cells were incubated with growth media (RPMI-1640 medium with 10% FBS with 11.1mM glucose) supplemented with various concentrations of oleate that had been bound to 2% fatty acid free BSA [22].

2.5. Insulin secretion analysis 

Insulin secretion to the media of INS-1 cells with various treatment were performed by incubating cells in Kreb's Ringer buffer with 0.2% BSA and low glucose (2.5mM) or high glucose (20mM) for 1h. Insulin secreted to the media were analyzed using radio-labeled immunoassay (RIA) kit for Rat insulin from Linco Research. Isolated islets were transferred to individual 12 well plates in group of 50 and treated with low (2.5mM) or high (20mM) glucose with and without GLP-1 (50nM) in Kreb's Ringer's buffer with 0.2% BSA. After 1h treatment, media were harvested for assay of insulin using RIA kit from Linco Research.

2.6. Histological and morphometric analysis of islets 

Pancreata from male and female mice were fixed in formalin, embedded in paraffin, sectioned, and stained with a polyclonal antibody against insulin (for avidin–biotin complex immunohistochemistry; Histo-Tec Laboratory, Hayward, CA) or with hematoxylin and eosin (H&E). H&E-stained non-sequential sections were used for computer-assisted morphometric analysis as described (VAS II; Video Systems, Huntington Beach, CA) [23]. First, we measured the area of each islet and counted the cells in each islet. At least 10 islets were evaluated for each mouse and four mice in each group. We then calculated the mean area of an islet and the mean area of an islet cell (islet area divided by number of islet cells) for each mouse. Results are presented as mean±S.D. for each group. Statistical significance was assessed using the Student t test. p<0.05 was considered to be significant.

2.7. Cell culture and transfection 

INS-1 cells were grown in RPMI-1640 medium supplemented with 10% FBS with 11.1mM glucose at 37°C under 5% CO2. For transient transfection, cells were subcultured at a density of 2×105cells/well in six well plates the day prior to incubation with 0.75μg of pcDNA3-HSL [24], or pcDNA3 vector, and 0.25μg of pCMV β-GAL in 10μl of lipofectin reagent. Cells were transfected following the procedure from Gibco-BRL, and harvested 40h after transfection.

2.8. Measurement of HSL as NCEH or TG lipase activity 

Measurement of HSL activity was performed using cholesterol ester (NCEH activity) and triacylglycerol substrates (TG lipase activity) following previously published procedures [24]. The results are expressed in nmol of cholesteryl oleate or trioleolyglycerol hydrolyzed/μg of protein.

2.9. Protein assay and immunoblotting 

Cells were scraped and briefly sonicated in 0.1ml of ice-cold TES containing 0.15M NaCl, 3% Triton X-100, 0.1% lauryl sarcosyl, and 1unit/ml leupeptin. Homogenates were centrifuged at 10,000×g for 15min, and supernatants were taken for protein assay using Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). Aliquots of supernatant were electrophoresed, transferred to nitrocellulose, incubated with anti-rat HSL/fusion protein IgG, and visualized by chemiluminescence as described previously [25].

2.10. Taqman real time PCR analysis 

Tissues were homogenized in TRIzol reagent and total RNA was extracted and purified using the RNeasy kit with RNase-free DNase I. Total RNA was reverse-transcribed in a 20μl reaction containing random primers and Superscript II enzyme. Real-time PCR was performed with an ABI Prism 7900 HT System using SYBR green master mix reagent and specific primer pairs selected with Primer Express software as described previously [17]. The relative mass of specific RNA was calculated by the comparative cycle of threshold detection method according to the manufacturer's instruction. Three independent sets of Taqman real time PCR were performed using different RNA preparation from the islets; each run of Taqman real-time PCR was conducted in triplicate.

2.11. Microarray analysis of gene expression profile in islets 

For the microarray expression analysis, six pancrea/group were pooled and islets isolated. Five hundred to six hundred islets were used in each total RNA isolation using the RNeasy kit (typical yield: 5–8μg total RNA/500 islets). 1–2μg of isolated RNA was amplified using T7 primer 5′ AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGCGCT and a template switch primer 5′ AAGCAGTGGTAACAACGCAGAGTACGCGGG. cDNA was synthesized using Superscript, and purified using a Bio-6 chromatograph column. cRNA was generated from cleaned cDNA via in vitro transcription, and then used to generate fluorescent probes for hybridization with a PancChip 2.2 microarray chip. After denaturing, the hybridization mix (labeled cRNA probe, with 3.4× SSC, 0.3% SDS, Cot1 human DNA, polyA RNA, tRNA, as well as T7 primer) were placed on the array under a glass cover slip, and placed in a hybridization chamber at 65°C with humidity maintained by a small reservoir of 3× SSC. After 16h, the chips were washed with solutions 1A (2× SSC, 0.03% SDS), 1B (2× SSC), 2 (1× SSC) and 3 (0.2× SSC), and scanned using a GenePix 4000a microarray scanner and analyzed using GenePixPro 4.0 software. The PancChip 2.2 microarray is a cDNA array and allows two-dye labeling during hybridization. We performed hybridization using wild type RNA and HSL−/− RNA at the same time, and then performed the same hybridization by “flipping” the dye for labeling the cRNA. This step was incorporated to allow us to eliminate inconsistent hybridization signals due to the labeling efficiency. Six animals were pooled for each RNA isolated. Four sets of RNA were isolated, and eight sets of microarray experiments were performed. The data generated from the microarray assays were normalized and analyzed using Stanford's statistical analysis tools, significance analysis of microarrays (SAM).

2.12. Statistical analysis 

Results are given as the mean±S.D. and statistical significance was tested using ANOVA and unpaired two-tailed Student's t test, except where otherwise stated, using StatView (version 4.5, Abacus Concepts, Berkley, CA) and InStat (version 2.03, GraphPad Software, San Diego, CA) software for Macintosh, and Microsoft Excel.

3. Results 

return to Article Outline

3.1. FFA loading increases the expression and activity of HSL in clonal β-cells 

To determine whether increased cellular TG alters HSL expression in β-cells, INS-1 cells were incubated with 1mM oleic acid for different times in RPMI-1640 (with 10% fetal bovine serum, 11.1mM glucose). Cells were then harvested and protein extracted. Immunoblotting using anti-HSL antibody showed that both the 84 and 89kDa isoform of HSL are expressed in pancreatic β-cells and adipose tissue. There was an increase of the β-cell specific 89kDa HSL in the cells that were loaded with 1mM oleic acid overnight (Fig. 1(a) lane3) compared with no FFA loading (lane 2). Lane 1 is a sample from adipose tissue. Equal amounts of total protein were loaded in lanes 2 and 3; the expression of the 84kDa isoform of HSL did not change with treatment. The TG content in the cells that were loaded with FFA is 1.6-fold higher than cells not treated with FFA (data not shown). This result shows that FFA loading increases the cellular TG content of β-cells and, at the same time, the expression of the β-cell form of HSL. In separate sets of experiments, INS-1 cells were loaded with different concentrations of oleate for overnight before harvesting. To eliminate the possible inhibitory effect of FFA in the cell extract on HSL hydrolytic activity, the procedure for measuring HSL hydrolytic activity was modified to include an additional step of protein precipitation under acidic conditions (pH 5.4). Proteins were washed and resuspended in buffer for measurement of activity. Neutral cholesterol ester hydrolase (NCEH) activity was assayed to represent HSL activity, since the NCEH activity in islets of HSL−/− mice is less than 15% of that of wild type mice (see Fig. 3(a)). Results show that (Fig. 1(b)) there is a more than two-fold increase of HSL activity with increasing concentrations of oleate to 0.3mM in the loading media after overnight loading compared to no FFA loading (p<0.005). When the concentrations of oleate in the loading media increased to 0.4, 0.5 and 1mM, there are still significant increase of HSL activity as compare with no FFA loading (p<0.05), although higher concentrations of oleate in the loading media do not increase HSL activity further.


View full-size image.

Fig. 1. FFA loading increases the expression and activity of HSL in clonal β-cells: (a) INS-1 cells were incubated with (lane 3) or without (lane 2) 1mM oleic acid for overnight in RPMI 1640 media. Cell were extracted in TES and blotted for immunoreactive protein with anti-HSL antibody. Lane 1 is a sample from adipocyte tissue. The results are representation of three sets of independent experiments. (b) INS-1 cells were incubated with different concentrations of oleate in RPMI 1640 media for overnight. Cells were washed with PBS and extracted in TES buffer. Proteins were precipitated at pH 5.4 before assay for HSL activity, results are means and standard deviations of four independent assays. *p<0.05, ***p<0.005 by t test.


3.2. GLP-1 increases HSL hydrolytic activity in INS-1 cells 

Recently, it was shown that a specific inhibitor of HSL can block GLP-1 potentiated GSIS in isolated rat islets [20], which further supports the importance of HSL in insulin secretion. In order to determine whether GLP-1 has any direct effects on HSL activity in β-cells, INS-1 cells were grown overnight in high glucose (20mM) to increase the amount of HSL protein. Cells were then washed with PBS, incubated in Kreb's Ringer buffer with 0.2% BSA and 2.5mM glucose, and then treated with different amounts of GLP-1 in low (2.5mM) or high (20mM) glucose for 1h. Media and cells were harvested for assay of insulin secretion and HSL activity, respectively. As shown in Fig. 2, treatment with 50nM GLP-1 resulted in increased HSL activity under both low (2.5mM) and high (20mM) glucose (Fig. 2(a)). With 2.5mM glucose, 50nM of GLP-1 treatment increased HSL activity almost three-fold (p<0.005); while with 20mM glucose there is an 60% increase in HSL activity above the increase of HSL activity induced by high glucose (p=0.013). The addition of a cAMP analogue (CPT) along with 50nM GLP-1 did not further increase HSL activity. Measurement of insulin secretion show that treatment of INS-1 cell with 50nM GLP-1 in high glucose lead to almost four-fold (p<0.05) increase in insulin secretion (Fig. 2(b)). No changes in HSL protein expression were observed under these conditions (Fig. 2(c)).


View full-size image.

Fig. 2. GLP-1 increase HSL hydrolytic activity in INS-1 cells: INS-1 cells were grown to 80% confluence in RPMI-1640 media supplemented with 11.1mM glucose and then switched to 20mM glucose overnight. Cells were then washed twice with PBS and then incubated twice for 30min in Kreb's Ringer buffer with 0.2% BSA and 2.5mM glucose before treatment with different amounts of GLP-1 and cAMP in low (2.5mM) or high (20mM) glucose for 1h. Media were collected for measurement of insulin (b) using RIA kit from Linco Research. Cells were harvested for assay of HSL activity (a), and HSL immunoreactive protein (c). Results presented are means and standard deviations of three independent experiments. *p<0.05, **p<0.01, ***p<0.005 by t test.


3.3. Islets of HSL−/− mice have decreased neutral cholesterol ester hydrolase activity and show decreased GLP-1 potentiated insulin secretion 

To study the contribution of HSL to islet lipase activity and GLP-1 potentiated insulin secretion, islets of wild type and HSL−/− mice were isolated (Fig. 3). Measurement of HSL activity using CE as substrate showed that the islets from HSL−/− mice retained <20% activity of control mice (p<0.05). However, using TG as substrate, activity was reduced only 30–40% (p<0.05), suggesting the presence in the islets of one or more other neutral TG lipases. This is consistent with previous papers showing decreased NCEH activity and TG lipase activity [19], [26]. It should be noted that glycerol release in islets was unaffected by the absence of HSL [19], [26]. Treatment of wild type islets with GLP-1 in the presence of high glucose showed a more than five-fold increase in insulin secretion (p<0.05). Islets from HSL−/− mice have higher basal insulin secretion (p<0.01), but fail to increase insulin secretion further in response to high glucose treatment. Addition of GLP-1 to the high glucose condition for the islets from HSL−/− mice showed a trend of increased insulin secretion, but did not reach statistical significance; the increase failed to reach the same level as that of islets from wild type mice (p=0.05).


View full-size image.

Fig. 3. Islets of HSL−/− mice lack NCEH activity, have decreased TG hydrolase activity and show decreased GLP-1 potentiated insulin secretion. Islets were isolated from 6 months old female HSL−/− and wild type mice. After overnight recovery in RPMI media with 10% FBS, islets were harvested and sonicated in TES buffer for HSL activity using cholesterol oleate (a) or triolein as substrate (b). (c) Islets were washed with PBS with 0.2% BSA and transferred to individual 12 well plates in groups of 50 and treated with low (2.5mM) or high glucose (20mM) with and without GLP-1 (50nM) in Kreb's Ringer's buffer with 0.2% BSA. After 1h treatment, media were harvested for assay of insulin secretion. Results presented are means and standard deviations of three sets of experiments. *p<0.05, **p<0.01 by t test.


3.4. Histopathology of HSL−/− mice 

HSL−/− mice display hypertrophy of adipocytes and accumulation of lipid in adrenal glands [27], [28]. H&E-stained sections of pancreata from HSL−/− mice showed hyperplasia of pancreatic islets (Fig. 4). Under both normal chow and high fat feeding condition, the islets of HSL−/− mice were significantly larger than islets of WT mice (normal chow p<0.005; high fat p<0.05). Mice on a high fat diet had larger islets than mice of the same genotype on a normal chow diet; however, the size difference was only significant for the HSL−/− mice (p<0.05). There were no differences in islet size between male and female mice (data not shown). Moreover, there were no differences between groups in the percentage of islet cells that expressed insulin (data not shown).


View full-size image.

Fig. 4. Histological changes in pancreatic islets. (A–H) Sections of pancreas from 27 week-old male mice in the fed state are shown. (A–D) haematoxylin and eosin staining; (E–H) anti-insulin immunostaining; (A and E), Normal chow (NC)-fed HSL+/+; (B and F) NC-fed HSL−/−; (C and G) High fat (HF)-fed HSL+/+; (D and H) HF-fed HSL−/−. Original magnification, ×10. Scale bars, 100μm. (I) Morphometric analysis was used to determine the area of each islet on three non-sequential sections of H&E-stained pancreata section, at least 10 islets were evaluated for each mouse. Results are presented as mean±S.D. for four mice in each group. *p<0.05, ***p<0.001, t test.


There were no significant differences between groups in the mean area of an islet cell (WT normal chow=99.1±3.28μm2; WT high fat=98.6±2.75μm2; HSL−/− normal chow=98.6±4.93μm2; HSL−/− high fat=95.9±4.19μm2; mean±S.D.; n=4 mice/group). Thus, the increase in islet size in the HSL−/− mice (as compared to WT mice) and in mice on a high fat diet (as compared to mice on normal chow) was due to an increase in the number of cells within each islet (hyperplasia), rather than to an increase in size (hypertrophy) of individual islet cells.

3.5. Gene expression profile in islets of HSL−/− mice and wild type mice 

In view of the morphological and biochemical changes in islets from HSL−/− mice, the gene expression profiles in islets isolated from HSL−/− mice was compared with wild type mice using the PancChip 2.2 from NIDDK. The PancChip 2.2 microarray contains three copies of 3139 non-redundant mouse IMAGE clones that were chosen using a combination of expression analysis and database mining [29]. Eight sets of PancChip 2.2 array experiments were performed; results were analyzed using significance analysis of microarray (SAM) [30] and summarized in Table 1. Significant changes in expression were observed in genes that are involved in metabolism, such as isocitrate dehydrogenase and HMG-CoA lyase precursor, which are involved in fatty acid oxidation and are both up-regulated 2-fold in HSL−/− mice (p<0.05). β-hydroxysteroid dehydrogenase, squalene synthase, and acryl-acylamidase, which are involved in lipid metabolism, also showed significant regulation. β-hydroxysteroid dehydrogenase and squalene synthase were down regulated 2.3–2.5-fold (p<0.05). Acryl-acylamidase, which can function as a microsomal lipase, was up-regulated 2.7-fold (p<0.05). Twelve genes involved in basic cellular functions, which include heat shock protein 84, synexin, and lysyl hydrolase isoform 2, also showed significant changes in gene expression (p<0.05). Other genes that showed changes in expression include genes involved in signal transduction (casein kinase II β-subunit, increased two-fold; serine/threonine kinase, increased 2.5-fold, p<0.05), genes involved in insulin secretion and signaling (succinyl-CoA synthase β-subunit precursor, increased two-fold p<0.05), as well as immune related genes (transforming protein RFP, increased two-fold; IgE-binding factor, decreased 2.8-fold; p<0.05). Thus, of the 3139 non-redundant mouse IMAGE clones contained on the PancChip 2.2 array, the expression of 17 was increased more than two-fold, while six were decreased more than two-fold.

Table 1.

Microarray comparison analysis of gene expression in islets between wild type and HSL−/− mice

CategoryGene nameFold (KO/WT) ΔAccession numberFunction
MetabolismSimilar to isocitrate dehydrogenase2.08AI173556Fatty acid oxidation
Branched chain α-ketoacid decaboxylase E1a2.01AI62247Ketoacid metabolism
Similar to HMG-CoA lyase precursor2.00AA838929Fatty acid oxidation
Uricase2.72AA237345Response to oxidative reaction
Lipid metabolismβ-Hydroxysteroid dehydrogenase−2.48AA450665Facilitate corticosteroid action
Squalene synthase−2.26Ai195100Cholesterogenic
Acryl-acylamidase2.66A53856Can function as microsomal lipase
Insulin secretion and signalingSuccinyl-CoA synthase β-subunit precursor2.11AA253809Possess histidine kinase activity, involved in insulin secretion
Signal transductionSimilar to casein kinase II β subunit1.98AI323164Kinase, involved in signaling transduction
Similar to serine/threonine kinase2.53AA286018Involved in signaling transduction
Immune relatedSimilar to IgE-binding factor−2.84AA896119Regulate the synthesis of B-cell-derived immunoglobulin
Transforming protein RFP1.99AI462889Associated with development
Large prolin-rich protein BAT31.98A1325425Involved in immune response of the cell
Basic cellular functionSynexin−2.43AA175243Ca binding protein, secretory function of the cell
Similar to B-myb2.06AA432951Cell cycle regulated transcription factor
UBF transcription factor−2.46AI893975DNA binding protein, control gene transcription
TGF-β binding protein5.37AI314962TGF complex component, involved in TGF signaling pathway
TGF receptor 12.34AI119338Involved in TGF signaling pathway
Lysyl hydrolase isoform 23.50AI605652Involved in post-translational modification for collagen
Similar to ZO-12.50AI326488Involved in cell proliferation and differentiation
Heat-shock protein 842.40AI875559Regulation of cell response to stress
Similar to P1202.34AA000495Inhibitor of TGF signaling pathway
Similar to GRB102.21AA260248Signaling through interaction with protein kinase B
Similar to cathepsin precursoe2.18AI644153Secretory vesicle, prohormone processing enzyme
Similar to ubiquitin-conjugating enzyme 22.13AA940461Protein processing
CytoskeletonActin-like protein 3−2.46AW106357Induce actin polymerization

For microarray expression analysis, six pancrea/group were pooled and islets isolated and total RNA isolation using the RNeasy kit. Eight set of PancChip 2.2 array experiments were performed (see Section 2 for detail), all changes listed here are with a p<0.05.

Some of the genes that are important for lipid metabolism were not present in the PancChip 2.2 array, therefore in addition to microarray analysis, we selected and analyzed some of the genes that are involved in lipid metabolism using Taqman quantitative real time PCR. Of the 15 genes we examined, seven showed significant changes (Table 2). Two of the enzymes that are involved in fatty acid and TG synthesis were up-regulated (SCD1 increased 10.6-fold, p<0.001; DGAT1, increased 2.7-fold; p<0.001). The expression of other enzymes for TG synthesis, such as glycerol-3-phosphate acyltransferase (GPAT), fatty acid synthase (FAS), and acetyl-CoA carboxylase-1 (ACC-1), however, were not changed. The expression of c/EBP-α tended to increase, but did not reach statistical significance (increased 5.2-fold, p=0.12). Interestingly, SREBP-1c and ATP-citrate lyase (ACLY) were both down-regulated (SREBP-1c, decreased 1.87-fold, p<0.001; ACLY, decreased 1.5-fold, p<0.05). As seen in some other tissues in HSL−/− mice, lipoprotein lipase expression in HSL−/− islets was also elevated (increased 15.7-fold, p<0.001).

Table 2.

Quantitative PCR analysis of gene expression in islets of wt and HSL−/− mice

GeneFold (KO/WT)
c/EBP-α+5.2±3.2
SREBP-1C−1.87±0.05**
SCD1+10.6±1.25**
DGAT1+2.7±0.2**
LPL+15.7±2.8**
UCP-1Not detected
UCP-2+5.8±1.76*
ACLY−1.5±0.045*
c/EBP-βNS
GPR40NS
ACC-1NS
ACRP-30NS
FASNS
GPATNS
PPAR-γNS

*p<0.05, **p<0.001 by t-test; NS: not significantly changed.

Recently, UCP-2 has been shown to be an important modulator of insulin secretion and the up-regulation of UCP-2 has been linked with disturbed insulin secretion. The expression of UCP-2 in the islets of HSL−/− mice was up-regulated by more than five-fold (p<0.05).

4. Discussion 

return to Article Outline

HSL functions as a hydrolase for the metabolism of triacylglycerols, diacylglycerols and cholesterol esters [1]. The rapid modulation of HSL in response to hormones through changes in its phosphorylation, subcellular localization and subsequent change in hydrolytic activity makes HSL an important regulator of cellular lipid homeostasis. An isoform of HSL has been identified in pancreatic β-cells [13]. Although accumulating data have indicated a role for HSL in regulating GSIS [15], [31], a recent report suggested that there is impairment of insulin sensitivity but not disturbed GSIS in HSL−/− mice [16]. In order to further study the involvement of HSL in regulating β-cell function and specifically GSIS, we have studied HSL expression under several conditions, i.e. FFA loading and GLP-1 treatment. We have shown here that FFA loading, which results in higher cellular TG accumulation, induces the expression of the β-cell form of HSL in the clonal β-cell line INS-1. These findings are consistent with the increased HSL expression in islets observed in animals that were fed a short-term high fat diet [32]. This response of HSL to TG accumulation can be viewed as a potential adaptive mechanism, with adaptation working on the hydrolysis of excess TG accumulation to prevent lipotoxicity. Recent studies using adenoviral overexpression of adipose HSL in rat islets have shown that increased expression of HSL in islets can ameliorate palmitate induced lipotoxicity in pancreatic β-cells (N. Fujita, Personal communication). With higher levels or prolonged TG accumulation, the detrimental effects of TG accumulation might not be easily corrected by an increase of HSL, thus resulting in lipotoxicity to β-cells and β-cell apoptosis. Apparently, HSL expression in islets starts to decline in high fat fed animals after 4 months of feeding [32], and changes of HSL were suggested as a mechanism of defense against FFA induced apoptosis. Supporting evidence comes from a recent demonstration that unsaturated fatty acids were shown to protect non-adipose cells against lipotoxicity through promotion of triglyceride accumulation [33]. There are several possible mechanisms by which FFA loading could increase HSL activity, one of them could be through the FFA facilitated interaction of HSL and fatty acid binding protein [34], which result in increased HSL activity; and another possibility could be through the up-regulation of HSL transcription via PPAR-γ and Sp-1 [35].

GLP-1 is known to potentiate insulin secretion by binding to GLP-1 receptors on β-cells, resulting in increased cellular cAMP levels. Recently, GLP-1 was shown to increase lipolysis and FFA release in the pancreatic β-cell line HIT-15 [36]. Our current data show that GLP-1 increases HSL activity in parallel to the potentiation of insulin secretion. Increased HSL activity would result in an increase in FFA release from stored TG in β-cells. Although the mechanism is still not clear, it has been proposed that FFA are converted to long-chain fatty acyl-CoAs and enter mitochondria for oxidation, resulting in an increased ATP:ADP ratio, and an increased insulin secretion [37]. This result is further supported by our studies using islets isolated from HSL−/− mice, where GLP-1 fails to stimulate insulin secretion to the same level as that observed in islets of wild type mice. Taken together, our data support the involvement of HSL in the signaling pathway for GLP-1 potentiated insulin secretion. Potentiation of insulin secretion by GLP-1, however, does not occur solely through HSL, since GLP-1 can increase insulin secretion in the absence of HSL, but stimulation is subnormal compared to wild type islets. During the preparation of this manuscript, Peyot et al., reported that HSL is not essential for GLP-1 action based on their results from 4 month old mice HSL−/− [19]. However, similar to our current observation, GLP-1 potentiated insulin secretion was attenuated in islets from 7 month old HSL−/− mice, indicating the involvement of HSL in this incretin action of GLP-1 [19].

Leptin has been shown to stimulate a novel form of lipolysis in which glycerol is released without a proportional release of FFA [38]. In addition, although leptin can suppress insulin hypersecretion in high glucose fed-rats [39], leptin has no effect on GSIS [40]. We have also studied the effect of leptin, no changes in β-cell HSL expression or activity were seen with leptin treatment in INS-1 cells (data not shown). Therefore, the expression and/or activity of the β-cell form of HSL changes in parallel to changes in GSIS, and HSL does not appears to be altered when GSIS is not affected.

Several different lines of HSL−/− mice have been reported [15], [27], [16], with some phenotypic variations related to insulin secretion observed. Initial observations [15] showed disturbed GSIS in HSL−/− mice, but recent reports from a different group [26] observed only impaired insulin sensitivity with intact insulin secretion, while conflicting results with insulin secretion were reported with mice of 4 month old versus 7 month old [19]. The mice used in the studies of Roduit et al. were generated from BALB/c to C57/BL/6J mice, whereas the mice used in studies of Mulder et al. were SV129/C57/BL/6J hybrid mice. Our HSL−/− mice were 129/Sv-C57BL6 hybrid descendants [17], [27], [28]. Therefore, the differences observed in insulin secretion by these various groups could be due to different genetic backgrounds and/or breeding of the mice, as well as the age of the mice studied. In our studies, we observed an increased basal insulin secretion, that is accompanied by a decreased stimulation of insulin secretion by high glucose, from islets isolated from 6-month old HSL−/− mice. Furthermore, we see a decreased response to GLP-1 stimulation of insulin secretion in the presence of high glucose in islets of HSL−/− mice. Thus, our data are consistent with the initial observations supporting the involvement of HSL in the signaling pathway for GSIS.

HSL−/− mice had significantly larger islets than WT mice, this observation is in agreement with larger islets seen with another line of HSL−/− mice [16], [26]. Furthermore, we have shown that mice on a high fat diet had larger islets than mice of the same genotype on a normal chow diet, which is in agreement with the present view that in non-diabetic obesity islets tend to be larger to compensate for the increased metabolic load and obesity-associated insulin resistance [41]. HSL−/− mice also had larger islets than WT mice under high fat feeding. Regardless of the feeding condition, the increases in mean islet size were due to an increase in the number of cells per islet (i.e. islet hyperplasia). The larger islets seen in HSL−/− mice might also be viewed as a compensatory mechanism for increased basal serum insulin levels seen in HSL−/− mice where peripheral insulin resistance has been observed [15], [16], [17].

Using microarray analysis and PancChip arrays, we have shown that multiple genes are altered in the islets of HSL−/− mice, including genes involved in lipid metabolism, cell cycle, basic cell functions, as well as immune related functions. Follow-up quantitative PCR confirmed the changes in the genes that are related to lipid metabolism. The up-regulation of SCD1 and DGAT1 are associated with TG accumulation. Although SREBP-1c and PPAR-γ have been shown to be important regulators that promote lipogenesis, no change in SREBP-1c mRNA levels has also been seen with lipogenesis regulated by growth hormone and/or insulin [42]. Interestingly, UCP-2 is up-regulated in the islets of HSL−/− mice. It has been shown that UCP-2 gene transcription can be up-regulated by FFA both in vivo under high fat feeding condition and in vitro in isolated islets [43], [44], [45], [46]; therefore, the up-regulation of UCP-2 mRNA is consistent with the increased TG accumulation and up-regulation of SCD1 and LPL in the islets of HSL−/− mice. The observation that UCP-2 gene expression is up-regulated in islets of HSL−/− mice is consistent with several recent reports showing that increased expression of UCP-2 in islets is associated with impaired GSIS [43], [47], [48], [49]. C/EBPα has been shown to be involved in the cytokine-regulated cell-death of β-cells [50]. In view of the 2–2.5-fold increase of TG in the islets of HSL−/− mice [51], the potential up-regulation of c/EBPα could be a response to over-accumulation of TG and a link between lipotoxicity and β-cell dysfunction. A recent study of transgenic mice over-expressing adipose HSL in pancreatic β-cells shows lipotoxicity of the β-cells and also an increase of UCP-2 expression in the islets [52]. The authors propose that increased expression of HSL in the islets of transgenic mice promotes the release of FFA, which is then used as a ligand for PPAR-γ and results in up-regulation of UCP-2, and hence decreased GSIS. On the one hand, it is interesting that both ablated expression of HSL and over-expression of HSL in islets result in up-regulation of UCP-2 and decreased GSIS. This might indicate that disturbed lipid homeostasis in islets causes changes in energy, altering UCP-2 levels. On the other hand, it is noteworthy that the pancreatic β-cell form of HSL is different from the adipose form of HSL and has a N-terminal extension. Therefore, the function and regulation of the β-cell isoform of HSL could be different from the adipose isoform.

In this report, we have shown that HSL activity and expression changes parallel changes in GSIS. When HSL expression is ablated in HSL−/− mice, there are changes in gene expression of a variety of different genes that appear to be associated with TG accumulation and disturbed insulin secretion.

Acknowledgments 

return to Article Outline

We thank Dr. Seung Kim from Stanford for his help with islet isolation, Dr. Vincent Poitout from Pacific Northwest Research Institute for his help with insulin RIA assay.

The PancChip 2.2 microarray was obtained from the NIDDK consortium.

This work was supported in part by research grants from American Diabetes Association (W.-J.S.), the Research Service of the Department of Veterans Affairs and by grant DK 46942 from the National Institutes of Health (F.B.K.), DK67592 from NIH (S.A.M.), and DK56339 from the National Institutes of Health Digestive Disease Center Grant (S.A.M.).

References 

return to Article Outline

[1]. [1]Kraemer F, Shen W-J. Hormone-sensitive lipase: control of intracellular tri-(di-)acylglycerol and cholesteryl ester hydrolysis. J. Lipid Res. 2002;43:1585–1594. MEDLINE | CrossRef

[2]. [2]Corkey B, Glennon MC, Chen KS, Deeney JT, Matschinsky FM, Prentki M. A role for malonyl-CoA in glucose-stimulated insulin secretion from clonal pancreatic-beta cells. J. Biol. Chem. 1989;264:21608–21612. MEDLINE

[3]. [3]Prentki M, Vischer S, Glennon MC, Regazzi R, Deeney JT, Corkey BE. Malonyl-CoA and long-chain acyl-CoA esters as metabolic coupling factors in nutrient-induced insulin secretion. J. Biol. Chem. 1992;267:5802–5810. MEDLINE

[4]. [4]Brun T, Roche E, Assimacopoulos-Jeannet F, Corkey BE, Kim KH, Prentki M. Evidence for an anaplerotic/malonyl-CoA pathway in pancreatic b-cell nutrient signaling. Diabetes. 1996;45:190–198. MEDLINE

[5]. [5]Chen S, Ogawa A, Ohneda M, Unger RH, Foster DW, McGarry JD. More direct evidence for a malonyl-CoA–carnitine palmitoyltransferase I interaction as key event in pancreatic beta-cell signaling. Diabetes. 1994;43:878–883. MEDLINE

[6]. [6]Deeney J, Gromada J, Hoy M, Olsen HL, Rhodes CJ, Prentki M, et al. Acute stimulation with long chain acyl-CoA enhances exocytosis in insulin-secreting cells (HIT T-15 and NMRI beta-cells). J. Biol. Chem. 2000;275:9363–9368. MEDLINE | CrossRef

[7]. [7]Nishizuka Y. Protein kinase C and lipid signaling for sustained cellular responses. FASEB J. 1995;9:484–496. MEDLINE

[8]. [8]Konrad RJ, Major CD, Wolf BA. Diacylglycerol hydrolysis to arachidonic acid is necessary for insulin secretion from isolated pancreatic islets: sequential actions of diacylglycerol and monoacylglycerol lipases. Biochemistry. 1994;33:13284–13294.

[9]. [9]Sheu L, Pasyk EA, Ji J, Huang X, Gao X, Varoqueaux F, et al. Regulation of insulin exocytosis by Munc13-1. J. Biol. Chem. 2003;278:27556–27563. MEDLINE | CrossRef

[10]. [10]Malaisse W, Dunlop ME, Mathias PC. Stimulation of protein kinase C and insulin release by 1-oleoyl-2-acetyl-glycerol. Eur. J. Biochem. 1985;149:23–27. MEDLINE | CrossRef

[11]. [11]Peter-Riesch B, Fathi M, Schlegel W, Wollheim CB. Glucose and carbachol generate 1,2-diacylglycerols by different mechanisms in pancreatic islets. J. Clin. Invest. 1988;81:1154–1161. MEDLINE | CrossRef

[12]. [12]Arkhammar P, Juntti-Berggren L, Larsson O, Welsh M, Nanberg E, Sjoholm A, et al. Protein kinase C modulates the insulin secretory process by maintaining a proper function of the beta-cell voltage-activated Ca2+ channels. J. Biol. Chem. 1994;269:2743–2749. MEDLINE

[13]. [13]Mulder H, Holst LS, Svensson H, Degerman E, Sundler F, Ahren B, et al. Hormone-sensitive lipase, the rate-limiting enzyme in triglyceride hydrolysis, is expressed and active in beta-cells. Diabetes. 1999;48:228–232. MEDLINE | CrossRef

[14]. [14]Winzell M, Svensson H, Arner P, Ahren B, Holm C. The expression of hormone-sensitive lipase in clonal β-cells and rat islets is induced by long-term exposure to high glucose. Diabetes. 2001;50:2225–2230. MEDLINE | CrossRef

[15]. [15]Roduit R, Masiello P, Wang SP, Li H, Mitchell GA, Prentki M. A role for hormone-sensitive lipase in glucose-stimulated insulin secretion. Diabetes. 2001;50:1970–1975. MEDLINE | CrossRef

[16]. [16]Mulder H, Sorhede-Winzell M, Contreras JA, Fex M, Strom K, Ploug T, et al. Hormone-sensitive lipase null mice exhibit signs of impaired insulin sensitivity whereas insulin secretion is intact. J. Biol. Chem. 2003;278:36380–36388. MEDLINE | CrossRef

[17]. [17]Harada K, Shen W-J, Patel S, Natu V, Wang J, Osuga JI, et al. Resistance to high fat diet-induced obesity associated with altered expression of adipose specific genes in hormone-sensitive lipase deficient mice. Am. J. Physiol. Endocrinol. Metab. 2003;285:E1182. MEDLINE

[18]. [18]Mulder H, Yang S, Winzell MS, Holm C, Ahrén B. Inhibition of lipase activity and lipolysis in rat islets reduces insulin secretion. Diabetes. 2004;53:122–128. MEDLINE | CrossRef

[19]. [19]Peyot M, Nolan CJ, Soni K, Joly E, Lussier R, Corkey BE, et al. Hormone-sensitive lipase has a role in lipid signaling for insulin secretion but is non-essential for the incretin action of glucagon-like peptide 1. Diabetes. 2004;53:1733–1742. MEDLINE | CrossRef

[20]. [20]Claus LD, Liang TH, Salhanick Y, Lubeski AI, Yang CK, Lemoine L, et al. Specific inhibition of hormone-sensitive lipase improves lipid profile while reducing plasma glucose. J. Pharmacol. Exp. Ther. 2005;14:(Epub ahead of print).

[21]. [21]Osuga J, Ishibashi S, Oka T, Yagyu H, Tozawa R, Fujimoto A, et al. Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity. Proc. Natl. Acad. Sci. U.S.A. 2000;97:787–792. MEDLINE | CrossRef

[22]. [22]Cousin S, Hügl SR, Wrede CE, Kajio H, Myers MG, Rhodes CJ. Free fatty acid-induced inhibition of glucose and insulin-like growth factor i-induced deoxyribonucleic acid synthesis in the pancreatic β-cell line INS-1. Endocrinology. 2001;142:229–240. MEDLINE | CrossRef

[23]. [23]Xu B, Wagner N, Pham LN, Magno V, Shan Z, Butcher EC, et al. Lymphocyte homing to bronchus-associated lymphoid tissue (BALT) is mediated by L-selectin/PNAd, 4β1 integrin/VCAM-1, and LFA-1 adhesion pathways. J. Exp. Med. 2003;197:1255–1267. MEDLINE | CrossRef

[24]. [24]Shen W-J, Patel S, Natu V, Kraemer FB. Mutational analysis of structural features of rat hormone-sensitive lipase. Biochemistry. 1998;37:8973–8979.

[25]. [25]Kraemer F, Patel S, Singh-Bist A, Gholami S, Saedi M, Sztalryd C. Detection of hormone-sensitive lipase in various tissues. II. Regulation in the rat testis by human chorionic gonadotropin. J. Lipid Res. 1993;34:609–616. MEDLINE

[26]. [26]Fex M, Olofsson CS, Fransson U, Bacos K, Lindvall H, Sorhede-Winzell M, et al. Hormone-sensitive lipase deficiency in mouse islets abolishes neutral cholesterol ester hydrolase activity but leaves lipolysis, acylglycerides, fat oxidation, and insulin secretion intact. Endocrinology. 2004;145:3746–3753. MEDLINE | CrossRef

[27]. [27]Osuga J, Ishibashi S, Oka T, Yagyu H, Tozawa R, Fujimoto A, et al. Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity. Proc. Natl. Acad. Sci. U.S.A. 2000;97:787–792. MEDLINE | CrossRef

[28]. [28]Kraemer F, Shen WJ, Harada K, Patel S, Osuga J, Ishibashi S, et al. Hormone-sensitive lipase is required for high-density lipoprotein cholesteryl ester-supported adrenal steroidogenesis. Mol. Endocrinol. 2004;18:549–557. MEDLINE | CrossRef

[29]. [29]Scearce LM, Brestelli JE, McWeeney SK, Lee CS, Mazzarelli J, Pinney DF, et al. Functional genomics of the endocrine pancreas: the pancreas clone set and PancChip, new resources for diabetes research. Diabetes. 2002;51:1997–2004. MEDLINE | CrossRef

[30]. [30]Tusher V, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U.S.A. 2001;97:5116–5121.

[31]. [31]Liang Y, Zhu J, Lemoin L, Salhanick A, Lowe D, Clairmont KB. Inhibition of hormone-sensitive lipase (HSL) reduces GLP-1, CCK and acetylcholine stimulated insulin release from isolated rat pancreatic islets. Diabetes. 2002;51:A359.

[32]. [32]Winzell MS, Holm C, Ahren B. Downregulation of islet hormone-sensitive lipase during long-term high-fat feeding. Biochem. Biophys. Res. Commun. 2003;304:273–278. CrossRef

[33]. [33]Listenberger L, Han X, Lewis SE, Cases S, Farese RV, Ory DS, et al. Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc. Natl. Acad. Sci. U.S.A. 2003;100:3077–3082. MEDLINE | CrossRef

[34]. [34]Jenkins-Kruchten AE, Bennaars-Eiden A, Ross JR, Shen W-J, Kraemer FB, Bernlohr DA. Fatty acid binding protein–hormone-sensitive lipase interaction; fatty acid dependence on binding. J. Biol. Chem. 2003;(Epub).

[35]. [35]Deng T, Shan S, Li PP, Shen ZF, Lu XP, Cheng J, et al. Peroxisome proliferator-activated receptor-gamma transcriptionally up-regulates hormone-sensitive lipase via the involvement of specificity protein-1. Endocrinology. 2006;147:875–884(Epub 2005, November 2003). MEDLINE | CrossRef

[36]. [36]Yaney G, Civelek VN, Richard AM, Dillon JS, Deeney JT, Hamilton JA, et al. Glucagon-like peptide 1 stimulates lipolysis in clonal pancreatic beta-cells (HIT). Diabetes. 2001;50:56–62. MEDLINE | CrossRef

[37]. [37]MacDonald P, El-Kholy W, Riedel MJ, Salapatek AM, Light PE, Wheeler MB. The multiple actions of GLP-1 on the process of glucose-stimulated insulin secretion. Diabetes. 2002;51:S434–S442.

[38]. [38]Wang M-Y, Lee Y, Unger RH. Novel form of lipolysis induced by leptin. J. Biol. Chem. 1999;274:17541–17544. MEDLINE | CrossRef

[39]. [39]Widdup G, Bryson JM, Pawlak D, Phuyal JL, Denyer GS, Caterson ID. In vivo and in vitro suppression by leptin of glucose-stimulated insulin hypersecretion in high glucose-fed rats. Eur. J. Endocrinol. 2000;143:431–437. MEDLINE | CrossRef

[40]. [40]Kawai T, Hirose H, Seto Y, Fujita H, Saruta T. Chronic effects of different fatty acids and leptin in INS-1 cells. Diabetes Res. Clin. Pract. 2001;51:1–8. Abstract | Full Text | Full-Text PDF (176 KB) | CrossRef

[41]. [41]Rhodes CJ. Type 2 diabetes-a matter of β-cell life and death?. Science. 2005;307:380–384. CrossRef

[42]. [42]Louveau I, Gondret F. GH and insulin affect fatty acid synthase activity in isolated porcine adipocytes in culture without any modifications of sterol regulatory element binding protein-1 expression. J. Endocrinol. 2004;181:271–280. MEDLINE | CrossRef

[43]. [43]Chan C, De-Leo D, Joseph JW, McQuaid TS, Ha XF, Xu F, et al. Increased uncoupling protein-2 levels in beta-cells are associated with impaired glucose-stimulated insulin secretion: mechanism of action. Diabetes. 2001;50:1302–1310. MEDLINE | CrossRef

[44]. [44]Joseph J, Koshkin V, Zhang CY, Wang J, Lowell BB, Chan CB, et al. Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes. 2002;51:3211–3219. MEDLINE | CrossRef

[45]. [45]Li L, Skorpen F, Egeberg K, Jorgensen IH, Grill V. Induction of uncoupling protein 2 mRNA in beta-cells is stimulated by oxidation of fatty acids but not by nutrient oversupply. Endocrinology. 2002;143:1371–1377. MEDLINE | CrossRef

[46]. [46]Medvedev A, Robidoux J, Bai X, Cao W, Floering LM, Daniel KW, et al. Regulation of the uncoupling protein-2 gene in INS-1 beta-cells by oleic acid. J. Biol. Chem. 2002;277:42639–42644. MEDLINE | CrossRef

[47]. [47]Lupi R, Dotta F, Marselli L, Guerra SD, Masini M, Santangelo C, et al. Prolonged exposure to free fatty acids has cytostatic and pro-apoptotic effects on human pancreatic islets: evidence that beta-cell death is caspase mediated, partially dependent on ceramide pathway, and Bcl-2 regulated. Diabetes. 2002;51:1437–1442. MEDLINE | CrossRef

[48]. [48]Lameloise N, Muzzin P, Prentki M, Assimacopoulos-Jeannet F. Uncoupling protein 2: a possible link between fatty acid excess and impaired glucose-induced insulin secretion?. Diabetes. 2001;50:803–809. MEDLINE | CrossRef

[49]. [49]Armstrong M, Towel HC. Polyunsaturated fatty acids stimulate hepatic UCP-2 expression via a PPARalpha-mediated pathway. Am. J. Physiol. Endocrinol. Metab. 2001;281:E1197–E1204. MEDLINE

[50]. [50]Darville M, Eizirik DL. Cytokine induction of Fas gene expression in insulin-producing cells requires the transcription factors NF-kappaB and C/EBP. Diabetes. 2001;50:1741–1748. MEDLINE | CrossRef

[51]. [51]Prentki M, Wang SP, Raphael R, Li H, Mitchell G, Masiello P. Hormone-sensitive lipase is essential for glucose stimulated insulin secretion. Diabetes. 2001;50:A52.

[52]. [52]Winzell MS, Svensson H, Enerback S, Ravnskjaer K, Mandrup S, Esser V, et al. Pancreatic β-cell lipotoxicity induced by overexpression of homrone-sensitive lipase. Diabetes. 2003;52:2057–2065. MEDLINE | CrossRef

a Department of Medicine, Stanford University, Stanford, CA 94305, United States

b VA Palo Alto Health Care System, Palo Alto, CA 94304, United States

c Department of Pathology, Stanford University, United States

d Department of Metabolic Disease, University of Tokyo, Tokyo 113, Japan

e Department of Internal Medicine, Jichi Medical School, Tochigi, Japan

Corresponding Author InformationCorresponding author at: Division of Endocrinology S025, Department of Medicine, Stanford University, Stanford, CA 94305-5103, United States. Tel.: +1 650 493 5000x60351; fax: +1 650 849 0215.

PII: S0168-8227(06)00175-6

doi:10.1016/j.diabres.2006.05.001


View previous. 4 of 22 View next.